Query (optional)   in Class  

GrainGenes Probe Report: GPW94035

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW94035
General Remarks
Motif (CT)20
Type
PCR
SSR
PCR primers
Forward TAGCCAGTCGGCTTGGTC
Reverse TCCAAAGAGTGACATTGAGCA
SSR size
208
Amplification Conditions
Amplification Tm = 60 degrees.
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre