Query (optional)   in Class  

GrainGenes Probe Report: GPW94039

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW94039
General Remarks
Motif (CTC)4, (CT)13
Type
PCR
SSR
PCR primers
Forward GGCGTACCTGAACATGCC
Reverse GGCTCCATTACATATCTCTCGC
SSR size
230
Amplification Conditions
Amplification Tm = 60 degrees.
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre