Query (optional)   in Class  

GrainGenes Probe Report: GPW94046

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW94046
General Remarks
Motif (TC)19
Type
PCR
SSR
PCR primers
Forward TTCTTACACAAAATACAATCT
Reverse TAAGCATGAGTATGGTAGC
SSR size
281
Amplification Conditions
Amplification Tm = 60 degrees.
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre