Query (optional)   in Class  

GrainGenes Probe Report: GPW94052

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW94052
General Remarks
Motif (AGA)5
Type
PCR
SSR
PCR primers
Forward AACCGCTAGAATCGGAACG
Reverse TGAGCCATCATTGGAACAAA
SSR size
335
Amplification Conditions
Amplification Tm = 60 degrees.
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre