Query (optional)   in Class  

GrainGenes Probe Report: GPW94054

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW94054  [ Marker Report ]
Locus
Xgpw94054
General Remarks
Motif (TA)11, (TG)14
Type
PCR
SSR
PCR primers
Forward GTCATCGTGCTCCGAAGG
Reverse CCGGTACTATAAGGTTTGGGG
SSR size
348
Amplification Conditions
Amplification Tm = 60 degrees.
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre