Query (optional)   in Class  

GrainGenes Probe Report: HVACL1

[ Printable Version ]  [ Submit comment/correction ]

Probe
HVACL1
Reference
ReferenceHayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80.
ReferenceBecker J and Heun M (1995) Barley microsatellites: allele variation and mapping Plant Molecular Biology 27:835-845.
General Remarks
PCR size is expected size (kb) based on published sequence.
Insert contains repeat (AT)7.
Type
PCR
SSR
PCR primers
5' TTTGGAATTATTCTGTGGGACC 3'
5' GGGATTCAATCAAGTATTCGGA 3'
Forward TTTGGAATTATTCTGTGGGACC
Reverse GGGATTCAATCAAGTATTCGGA
SSR size
0.150
Sequence
M58753
Source Gene Class
Acyl carrier protein I
Source Species
Hordeum vulgare
Data Source
Heun, Manfred97.03.11