Query (optional)   in Class  

GrainGenes Probe Report: HVADH1

[ Printable Version ]  [ Submit comment/correction ]

Probe
HVADH1
Reference
ReferenceBecker J and Heun M (1995) Barley microsatellites: allele variation and mapping Plant Molecular Biology 27:835-845.
General Remarks
PCR size is expected size (kb) based on published sequence.
Insert contains repeat (TGC)7.
Type
SSR
PCR primers
5' GAATTCTCATGAGGGATGCTTC 3'
5' CAACTGAAACTCATGGCCAT 3'
SSR size
0.206
Sequence
X07774
Source Gene Class
Alcohol dehydrogenase
Source Species
Hordeum vulgare
Data Source
Heun, Manfred97.03.11