Query (optional)   in Class  

GrainGenes Probe Report: HVBARE1

[ Printable Version ]  [ Submit comment/correction ]

Probe
HVBARE1
Reference
ReferenceBecker J and Heun M (1995) Barley microsatellites: allele variation and mapping Plant Molecular Biology 27:835-845.
General Remarks
PCR size is expected size (kb) based on published sequence.
Copia-like retroelement.
Insert contains repeat (G)16.
Type
PCR
SSR
PCR primers
5' GGTTTCCGGAATGGTCCGGAAACGAA 3'
5' TCTTGGGCTTGCCCACAAGCCCACTA 3'
SSR size
0.214
Sequence
Z17327
Source Species
Hordeum vulgare
Data Source
Heun, Manfred97.03.11