Query (optional)   in Class  

GrainGenes Probe Report: HVBDG

[ Printable Version ]  [ Submit comment/correction ]

Probe
HVBDG  [ Marker Report ]
Locus
HvBDG
Reference
ReferenceBecker J and Heun M (1995) Barley microsatellites: allele variation and mapping Plant Molecular Biology 27:835-845.
General Remarks
PCR size is expected size (kb) based on published sequence.
Insert contains repeat (CT)6.
Type
PCR
SSR
PCR primers
5' GAGAGAGAAAGAGAATGGCAGG 3'
5' AAAAAACTGCACCCAATCACTT 3'
SSR size
0.145
Sequence
X52572
Source Gene Class
(1->3,1->4)-beta-glucan 4-glucanohydrolase
Source Species
Hordeum vulgare
Data Source
Heun, Manfred97.03.11