Query (optional)   in Class  

GrainGenes Probe Report: HVCMA

[ Printable Version ]  [ Submit comment/correction ]

HVCMA  [ Marker Report ]
ReferenceBecker J and Heun M (1995) Barley microsatellites: allele variation and mapping Plant Molecular Biology 27:835-845.
General Remarks
PCR size is expected size (kb) based on published sequence.
Insert contains repeat (AT)9.
GTAAAGCAAATGTTGAGCAACG produced clearer bands than the alternative (overlapping) primer, GAGCAACGGGAGTCTCACATAT.
PCR primers
SSR size
Source Gene Class
Inhibitor of alpha-amylase
Source Species
Hordeum vulgare
Data Source
Heun, Manfred97.03.11