Query (optional)   in Class  

GrainGenes Probe Report: HVCSG

[ Printable Version ]  [ Submit comment/correction ]

Probe
HVCSG  [ Marker Report ]
Locus
HVCSG
Reference
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
ReferenceBecker J and Heun M (1995) Barley microsatellites: allele variation and mapping Plant Molecular Biology 27:835-845.
General Remarks
PCR size is expected size (kb) based on published sequence.
Insert contains repeats (GT)4 and (G)17.
Type
PCR
SSR
PCR primers
5' CACTTGCCTACCTCGATATAGTTTGC 3'
5' GTGGATTCCATGCATGCAATATGTGG 3'
SSR size
0.196
Sequence
X58339
Source Gene Class
Chalcone synthase
Source Species
Hordeum vulgare
Data Source
Heun, Manfred97.03.11