Query (optional)   in Class  

GrainGenes Probe Report: HVDHN9

[ Printable Version ]  [ Submit comment/correction ]

Probe
HVDHN9  [ Marker Report ]
Locus
HVDHN009
Reference
ReferenceHayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80.
ReferenceBecker J and Heun M (1995) Barley microsatellites: allele variation and mapping Plant Molecular Biology 27:835-845.
General Remarks
PCR size is expected size (kb) based on published sequence.
mRNA for dehydrin-9.
Insert contains repeat (TG)6.
Type
PCR
SSR
PCR primers
5' CATGGACAAGATCAAGGAGAAG 3'
5' CCCATTATTTATCTGTAGGAACGC 3'
Forward CATGGACAAGATCAAGGAGAAG
Reverse CCCATTATTTATCTGTAGGAACGC
SSR size
0.128
Sequence
X15289
Source Gene Class
Dehydrin
Source Species
Hordeum vulgare
Data Source
Heun, Manfred97.03.11