Query (optional)   in Class  

GrainGenes Probe Report: HVGNIRE

[ Printable Version ]  [ Submit comment/correction ]

Probe
HVGNIRE  [ Marker Report ]
Locus
HVGNIRE
Reference
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
ReferenceBecker J and Heun M (1995) Barley microsatellites: allele variation and mapping Plant Molecular Biology 27:835-845.
General Remarks
PCR size is expected size (kb) based on published sequence.
Insert contains repeats (TG)6 and (G)14.
Type
PCR
SSR
PCR primers
5' GAGTTGCAACAACAACAGGGTA 3'
5' GTCATGCACATCATCGAGATCT 3'
GAGTTGCAACAACAACAGGGTA
GTCATGCACATCATCGAGATCT
SSR size
0.136
Sequence
X57845
Source Gene Class
Nitrate reductase
Source Species
Hordeum vulgare
Data Source
Heun, Manfred97.03.11