Query (optional)   in Class  

GrainGenes Probe Report: HVLEU

[ Printable Version ]  [ Submit comment/correction ]

Probe
HVLEU  [ Marker Report ]
Locus
HVLEU
M-HVLEU
Reference
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceLiu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
ReferenceBecker J and Heun M (1995) Barley microsatellites: allele variation and mapping Plant Molecular Biology 27:835-845.
General Remarks
PCR size is expected size (kb) based on published sequence.
Insert contains repeat (ATTT)4.
Type
SSR
PCR primers
5' TTGGAAGTGTACAGCAATGGAG 3'
5' TGAAAGGCCCCACAAGATAG 3'
TTGGAAGTGTACAGCAATGGAG
TGAAAGGCCCCACAAGATAG
SSR size
0.166
Sequence
X05167
Source Gene Class
Aleurain
Source Species
Hordeum vulgare
Data Source
Heun, Manfred97.03.11