Query (optional)   in Class  

GrainGenes Probe Report: HVM44

[ Printable Version ]  [ Submit comment/correction ]

Probe
HVM44  [ Marker Report ]
Locus
HVM44
HVM0044
HVM044
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
ReferenceLiu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
General Remarks
Insert contains repeat (GA)8.
Type
PCR
SSR
PCR primers
5' AAATCTCAGGTTCGTGGGCA 3'
5' CCACGGAGACCACCTCACTT 3'
AAATCTCAGGTTCGTGGGCA
CCACGGAGACCACCTCACTT
SSR size
0.114
Amplification Conditions
The 'touchdown' PCR comprised 48 cycles of 94oC for 1 min denaturing and 72oC for 1 min extension. Annealing (30 s) temperatures were progressively decreased by 1oC every second cycle from 64oC to 55oC. Annealing conditions of 1 min at 55oC were maintained during the final 30 cycles. The reaction ended with a 5-min extension at 72oC.
Insert Enzyme
TaqI
Source Species
Hordeum vulgare
Source Germplasm
Old ZZ (barley)
DNA Origin
Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.
Clone Vector
pGEM-7zf(+)
Vector Enzyme
ClaI
Data Source
Saghai Maroof, M.A.97.01.02