Query (optional)   in Class  

GrainGenes Probe Report: HVM4

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
HVM4  [ Marker Report ]
Locus
HVM4
HVM0004
HVM004
HVM04
Reference
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceLiu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
ReferenceSaghai Maroof MA et al. (1994) Extraordinarily polymorphic microsatellite DNA in barley: species diversity, chromosomal locations, and population dynamics. Proceedings of the National Academy of Sciences, USA 91:5466-5470.
General Remarks
Insert contains repeat (AT)9.
Type
PCR
SSR
PCR primers
5' AGAGCAACTACCAGTCCAATGGCA 3'
5' GTCGAAGGAGAAGCGGCCCTGGTA 3'
AGAGCAACTACCAGTCCAATGGCA
GTCGAAGGAGAAGCGGCCCTGGTA
SSR size
0.198
Amplification Conditions
PCR comprised one cycle of 94oC for 3 min, 55oC for 2 min, and 72oC for 1.5 min, followed by 30 cycles of 94oC for 1 min, 55oC for 2 min, and 72oC for 1.5 min.
Sequence
X07931
Insert Enzyme
TaqI
Source Gene Class
Starch synthase
Source Species
Hordeum vulgare
Source Germplasm
Old ZZ (barley)
DNA Origin
Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.
Clone Vector
pGEM-7zf(+)
Vector Enzyme
ClaI
Data Source
Saghai Maroof, M.A.97.01.02

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.