Query (optional)   in Class  

GrainGenes Probe Report: HVPRP1B

[ Printable Version ]  [ Submit comment/correction ]

Probe
HVPRP1B  [ Marker Report ]
Locus
HVPRP1B
M-HVPRP1B
Reference
ReferenceBecker J and Heun M (1995) Barley microsatellites: allele variation and mapping Plant Molecular Biology 27:835-845.
General Remarks
PCR size is expected size (kb) based on published sequence.
Pathogenesis-related protein.
Insert contains repeats (GT)6 and (AT)16.
Type
SSR
PCR primers
5' ATAACTACCAGATCACCTTCTGCC 3'
5' GGAACGAAGGGAGTATTAAGCA 3'
SSR size
0.167
Sequence
X58566
Source Species
Hordeum vulgare
Data Source
Heun, Manfred97.03.11