Query (optional)   in Class  

GrainGenes Probe Report: HVRCABG

[ Printable Version ]  [ Submit comment/correction ]

Probe
HVRCABG  [ Marker Report ]
Locus
M-HVRCABG
HVRCABG
RuAc
Reference
ReferenceBecker J and Heun M (1995) Barley microsatellites: allele variation and mapping Plant Molecular Biology 27:835-845.
General Remarks
PCR size is expected size (kb) based on published sequence.
Insert contains repeat (AT)29.
Type
SSR
PCR primers
5' ACACCTTCCCAGGACAATCC 3'
5' CAGAGCACCGAAAAAGTCTGTA 3'
SSR size
0.182
Sequence
M55449
Source Gene Class
Ribulose bisphosphate carboxylase activase
Source Species
Hordeum vulgare
Data Source
Heun, Manfred97.03.11