Query (optional)   in Class  

GrainGenes Probe Report: HVSIP1A

[ Printable Version ]  [ Submit comment/correction ]

Probe
HVSIP1A
Reference
ReferenceBecker J and Heun M (1995) Barley microsatellites: allele variation and mapping Plant Molecular Biology 27:835-845.
General Remarks
PCR size is expected size (kb) based on published sequence.
SIP 1 gene.
Insert contains repeat (CTT)5.
Type
SSR
PCR primers
5' AACAATGTGTACGTCCACGC 3'
5' ATTCCACACAAGCAACATTCAG 3'
SSR size
0.149
Sequence
M77475
Source Species
Hordeum vulgare
Data Source
Heun, Manfred97.03.11