Query (optional)   in Class  

GrainGenes Probe Report: HvKASI

[ Printable Version ]  [ Submit comment/correction ]

Probe
HvKASI  [ Marker Report ]
Locus
HvKASI
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceBecker J and Heun M (1995) Barley microsatellites: allele variation and mapping Plant Molecular Biology 27:835-845.
Type
SSR
PCR primers
ATTGGCGTGACCGATATTTATGTTCA
CAAAACTGCAGCTAAGCAGGGGAACA