Query (optional)   in Class  

GrainGenes Probe Report: IB-267

[ Printable Version ]  [ Submit comment/correction ]

Probe
IB-267  [ Marker Report ]
Locus
SrR
Reference
ReferenceMago R et al. (2002) Identification and mapping of molecular markers linked to rust resistance genes located on chromosome 1RS of rye using wheat-rye translocation lines Theoretical and Applied Genetics 104:1317-1324.
Type
STS
STS primers
5' GCAAGTAAGCAGCTTGATTTAGC 3'
5' AATGGATGTCCCGGTGAGTGG 3'