Query (optional)   in Class  

GrainGenes Probe Report: IWA4434

[ Printable Version ]  [ Submit comment/correction ]

Probe
IWA4434
Locus
IWA4434
Reference
ReferenceBabiker EM et al. (2015) Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace Theoretical and Applied Genetics 128:605-612.
ReferenceMAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. QSr.abr-7AL MAS Wheat. Marker Assisted Selection in Wheat.
PCR primers
F_ALT: 5' GGCAGCAAGAAGAGAAAGAAAGGATT F_ALC: 5' GCAGCAAGAAGAGAAAGAAAGGATC
R: 5' CAGCGGCCTTCACCTGGGCTT
Specificity
Forward primers are allele specific for SNPs T and C, respectively