Query (optional)   in Class  

GrainGenes Probe Report: IWAB8036

Probe
IWAB8036
Locus
IWB48036
Reference
ReferenceBabiker EM et al. (2015) Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace Theoretical and Applied Genetics 128:605-612.
ReferenceMAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. QSr.abr-7AL MAS Wheat. Marker Assisted Selection in Wheat.
PCR primers
F_ALA: 5' ATCTCGTTTCCATTCATCTTGTACTTATA F_ALG: 5' CTCGTTTCCATTCATCTTGTACTTATG
R: 5' AGCCAGTTGCTCCCACTCTATGTTT
Specificity
Forward primers are allele specific for SNPs A and G, respectively