Query (optional)   in Class  

GrainGenes Probe Report: KASP-Gb5-1

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
KASP-Gb5-1
Reference
ReferenceXu X et al. (2021) Development of KASP markers for wheat greenbug resistance gene Gb5 Crop Science 61:490-499.
General Remarks
Alleles = T/C
Type
KASP
PCR
PCR primers
Allele specific primer 1 CGATTGTGGGGCTTCTTTTTCTTC
Allele specific primer 2 CGATTGTGGGGCTTCTTTTTCTTT
Common primer CAGTTCCGAAATATAAATGTTTCTGCAG
Source Gene
Gb5 (Triticum)

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.