Query (optional)   in Class  

GrainGenes Probe Report: KSUM176

[ Printable Version ]  [ Submit comment/correction ]

Probe
KSUM176
Reference
ReferenceFu YB et al. (2007) Microsatellite variation in Avena sterilis oat germplasm Theoretical and Applied Genetics 114:1029-1038.
ReferenceYu J-K et al. (2004) Development and mapping of EST-derived simple sequence repeat markers for hexaploid wheat Genome 47:805-818.
General Remarks
In 369 Avena sterilis accessions there were 7 alleles of size 42-270 bp, PIC = negative.
Repeat sequence (CTG)8
Type
PCR
SSR
EST
PCR primers
ATGCTCAAGCCGAGGAAGTA
ATGTCACCCATAGGAACGGA
Source Species
Triticum aestivum
Data Source
Fu, Yong-Bi2007.04