Query (optional)   in Class  

GrainGenes Probe Report: KV1/KV9

[ Printable Version ]  [ Submit comment/correction ]

Probe
KV1/KV9  [ Marker Report ]
Locus
Hor2
kv1.9A
kv1.9B
kv1.9C
Reference
ReferencePortyanko VA et al. (2001) A linkage map of hexaploid oat based on grass anchor DNA clones and its relationship to other oat maps Genome 44:249-265.
Type
PCR
STS
PCR primers
KV1 : 5' CCACCATGAAGACCTTCCTC
KV9 : 5' TCGCAGGATCCTGTACAACG
Sequence
X03103
Source Gene Class
B-Hordein
Source Gene
Hor2 (Hordeum)
Source Species
Hordeum vulgare