Query (optional)   in Class  

GrainGenes Probe Report: MAG3089

Probe
MAG3089
Reference
ReferenceXue S et al. (2008) A high-density intervarietal map of the wheat genome enriched with markers derived from expressed sequence tags. Theoretical and Applied Genetics 117:181-189.
Type
STS
PCR primers
Forward ATCGCCAACGGAAGACTG
Reverse GGAGAACTGATACATCTACGCCTAC
Amplification Conditions
Anneal 55
Sequence
BQ904399
Source Species
Triticum aestivum
Clone Location
Ma, Zhengqiang