Query (optional)   in Class  

GrainGenes Probe Report: MAG3433

[Submit comment/correction][What is a probe?]

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
MAG3433  [ Marker Report ]
Locus
Xmag3433
mag3433
mag3433-7A
Reference
ReferenceXue S et al. (2008) A high-density intervarietal map of the wheat genome enriched with markers derived from expressed sequence tags. Theoretical and Applied Genetics 117:181-189.
Type
STS
PCR primers
Forward TTCGAGGACAGAAGCTCCAT
Reverse TGGGCTCTAGGTTTCTCAGC
Amplification Conditions
Anneal 52
Sequence
BQ902887
Source Species
Triticum aestivum
Clone Location
Ma, Zhengqiang

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.