Query (optional)   in Class  

GrainGenes Probe Report: MWG2031

[ Printable Version ]  [ Submit comment/correction ]

Probe
MWG2031  [ Marker Report ]
Locus
MWG2031
Xmwg2031
MWG2031-7H
Type
Genomic
STS
STS primers
5' AACGCTCTGTGTTTCCAGACC
5' TGCAGTATGAGTTGCCAGC
STS size
ca. 1200
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
AJ234722
AJ234721
MWG2031
MWG2031-5
MWG2031-3
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03