Query (optional)   in Class  

GrainGenes Probe Report: MWG2065

[ Printable Version ]  [ Submit comment/correction ]

Probe
MWG2065  [ Marker Report ]
Locus
MWG2065
MWG2065(IF)
MWG2065(HT)
Type
Genomic
STS
STS primers
5' GGGAGCACGAGGGAGACGTT
5' CCTCTTCGTGCAAGCTTCGA
STS size
266
Amplification Conditions
STS annealing temperature 62-65 oC
Sequence
AJ234747
AJ234746
MWG2065-5
MWG2065-3
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03