Query (optional)   in Class  

GrainGenes Probe Report: MWG2135

[ Printable Version ]  [ Submit comment/correction ]

Probe
MWG2135  [ Marker Report ]
Locus
MWG2135
Synonym
SynonymHAR35_19261
Type
Genomic
STS
STS primers
5' GAAGACAAGCAGCAGCGACG
5' CAGGTATGCTTCGTGATCGCG
STS size
ca. 700
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
AJ234796
AJ234795
MWG2135-5
MWG2135-3
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03