Query (optional)   in Class  

GrainGenes Probe Report: MWG2266

[ Printable Version ]  [ Submit comment/correction ]

Probe
MWG2266  [ Marker Report ]
Locus
MWG2266
MWG2266-3H
Synonym
SynonymHAR35_3067
STS primers
5' GTCACCAGTTGTGTAAGGTGG
5' AACAGGAGGTTGTTCAGCAGC
STS size
377
Amplification Conditions
STS annealing temperature 60-62 oC
Sequence
AJ234871
MWG2266-5
Data Source
Kuenzel, Gottfried00.03