Query (optional)   in Class  

GrainGenes Probe Report: MWG514

[ Printable Version ]  [ Submit comment/correction ]

Probe
MWG514  [ Marker Report ]
Locus
MWG514
[ Show all 6 ]
Reference
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
Genomic
STS
STS primers
5' GTGCATTAATACAGTGCCCA
5' CACAAACGTTACGAGTACAG
STS size
472
Amplification Conditions
STS annealing temperature 50-52 oC
Sequence
AJ234478
AJ234477
MWG514-5
MWG514-3
Linkage Group
5H
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Insert Size
1
Clone Vector
Bluescript
pBluescr.
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
ATMI92.09
Kuenzel, Gottfried00.03