Query (optional)   in Class  

GrainGenes Probe Report: MWG533

[ Printable Version ]  [ Submit comment/correction ]

Probe
MWG533  [ Marker Report ]
Locus
MWG533
MWG533A
Type
Genomic
STS
STS primers
5' TGTGAGACTGTGACCGCTGG
5' ACGTGTGTGGCTGTGTGTAGG
STS size
181
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
AJ234492
AJ234491
MWG533-5
MWG533-3
Linkage Group
5H
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Insert Size
1.3
Clone Vector
Bluescript
pBluescr.
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
ATMI92.09
Kuenzel, Gottfried00.03