Query (optional)   in Class  

GrainGenes Probe Report: MWG539

[ Printable Version ]  [ Submit comment/correction ]

Probe
MWG539  [ Marker Report ]
Locus
MWG539
Xmwg539
Xmwg539-4R
Synonym
SynonymHAR35_18113
Type
Genomic
STS
STS primers
5' GCACTGCCCAATTCTTGC
5' CTTGATCTCCTTCGGGAGCG
STS size
ca. 900
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
AJ234494
AJ234493
MWG539-5
MWG539-3
Linkage Group
7H
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Insert Size
1.2
Clone Vector
Bluescript
pBluescr.
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
ATMI92.09
Kuenzel, Gottfried00.03