Query (optional)   in Class  

GrainGenes Probe Report: MWG573

[ Printable Version ]  [ Submit comment/correction ]

Probe
MWG573  [ Marker Report ]
Locus
MWG573
[ Show all 12 ]
Synonym
SynonymHAR35_18027
HAR35_50874
Type
Genomic
STS
STS primers
5' CTGCACTCATGTCAGCAAGA
5' GACCAACGGGAGATGCTCGT
STS size
240
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
AJ234515
AJ234514
MWG573-5
MWG573-3
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03