Query (optional)   in Class  

GrainGenes Probe Report: MWG582

[ Printable Version ]  [ Submit comment/correction ]

Probe
MWG582  [ Marker Report ]
Locus
MWG582
Synonym
SynonymHAR35_50339
Type
Genomic
STS
STS primers
5' CCTCAGGCTGGTTGAAGAAGC
5' GCCGACAGTTTGTTCTGACCGATAC
STS size
488
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
AJ234521
MWG582-5
Linkage Group
3H
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Insert Size
0.6
Clone Vector
Bluescript
pBluescr.
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
ATMI92.09
Kuenzel, Gottfried00.03