Query (optional)   in Class  

GrainGenes Probe Report: MWG60

[ Printable Version ]  [ Submit comment/correction ]

Probe
MWG60  [ Marker Report ]
Locus
Xmwg060
[ Show all 11 ]
General Remarks
single - low copy probe
Type
Genomic
PCR
STS
PCR primers
R:CTGGATAGAGAAGCCATGGA
L:CAACGATACAACAGGCTCAA
Amplification Conditions
Anneal at 45oC.
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Insert Size
1.3
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Data Source
Talbert, Luther E.97.01
DeScenzo, Richard A.94.12