Query (optional)   in Class  

GrainGenes Probe Report: MWG632

[ Printable Version ]  [ Submit comment/correction ]

Probe
MWG632  [ Marker Report ]
Locus
MWG632b
[ Show all 7 ]
Synonym
SynonymHAR35_730
Type
Genomic
STS
STS primers
5' CAACAGCAGCACAAGGTCGCTGCCT
5' GGTGGAAGCCAAGTCTGACATCGTC
STS size
473
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
AJ234546
MWG632-5
Polymorphism
MWG632 EcoRI
[ Show all 6 ]
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Graner, Andreas
Clone Authority
Graner, Andreas
Image
MWG632 BROWSSM autoradiogram
MWG632 SO autoradiogram
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03