Query (optional)   in Class  

GrainGenes Probe Report: MWG635

[ Printable Version ]  [ Submit comment/correction ]

Probe
MWG635  [ Marker Report ]
Locus
[ Hide all but 1 of 10 ]
MWG635C
MWG635b
MWG635a
RI003O16
RI002M19
MWG635A(HT)
Xmwg635
MWG635d
MWG635a-4H
MWG635
Synonym
SynonymHAR35_27222
HAR35_27940
Reference
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
Genomic
STS
STS primers
5' ACCGACGCAGACCTTCAG
5' TCAAGACCATGAAGCACGAG
STS size
178
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
AJ234550
MWG635-5
MWG635-3
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03