Query (optional)   in Class  

GrainGenes Probe Report: MWG649

[ Printable Version ]  [ Submit comment/correction ]

Probe
MWG649  [ Marker Report ]
Locus
Xmwg649
MWG649a
MWG649b
Synonym
Please seecMWG649
Reference
ReferenceKunzel G et al. (2000) Integration of deletion breakpoints of chromosome 7H (1) into the Igri/Franka-derived RFLP Barley Genetics Newsletter 30:24-27.
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
General Remarks
cMWG649 is the correct designation. MWG649 does not exist. (Personal communication from Andreas Graner, September 2005.)
STS primers
5' CAACACTCCGTCAACCAGCAACCTC
5' GCCTGCGTTGTTGAATGCG
STS size
441
Amplification Conditions
STS annealing temperature 55 - 58 oC