Query (optional)   in Class  

GrainGenes Probe Report: MWG68

[ Printable Version ]  [ Submit comment/correction ]

Probe
MWG68  [ Marker Report ]
Locus
Xmwg68-1
[ Show all 10 ]
General Remarks
single - low copy probe
Type
Genomic
PCR
STS
PCR primers
R:GGTGAGCTGCGCCAGTTCTA
L:CCCATGCCATAGTCCTGGGAA
Amplification Conditions
Anneal at 45oC.
Polymorphism
MWG68 EcoRI
MWG68 EcoRV
MWG68 HindIII
MWG68 XbaI
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Insert Size
0.58
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Image
MWG68 BROWS autoradiogram
MWG68 SO autoradiogram
Data Source
Talbert, Luther E.97.01
DeScenzo, Richard A.94.12