Query (optional)   in Class  

GrainGenes Probe Report: MWG798

[ Printable Version ]  [ Submit comment/correction ]

Probe
MWG798  [ Marker Report ]
Locus
MWG798A
[ Show all 8 ]
Reference
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
Genomic
STS
STS primers
5' GGCTGTCTACATCTTCTGCA
5' CAAGTGTTGAGAAGGAGAGT
STS size
365
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
AJ234554
AJ234553
MWG798-5
MWG798-3
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03