Query (optional)   in Class  

GrainGenes Probe Report: MWG800

[ Printable Version ]  [ Submit comment/correction ]

Probe
MWG800  [ Marker Report ]
Locus
MWG800
Xmwg800-1
MWG800-1H
Synonym
SynonymHAR35_3315
HAR35_5111
Type
Genomic
STS
STS primers
5' GTCCGTAACCTGTGGTACTG
5' GCAGCTAAGTTGGCTAGAGC
STS size
400
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
AJ234557
MWG800-5
Linkage Group
1H
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Insert Size
0.8
Clone Vector
Bluescript
pBluescr.
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
ATMI92.09
Kuenzel, Gottfried00.03