Query (optional)   in Class  

GrainGenes Probe Report: MWG813

Probe
MWG813  [ Marker Report ]
Locus
MWG813a
[ Show all 8 ]
Synonym
SynonymHAR35_15734
HAR35_2555
HAR35_2556
Reference
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
Genomic
STS
STS primers
5' TTGGACAGGATGTTGCCA
5' CATTCAGTAACACCGCCATG
STS size
115
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
AJ234569
AJ234568
MWG813-5
MWG813-3
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03