Query (optional)   in Class  

GrainGenes Probe Report: MWG851

[ Printable Version ]  [ Submit comment/correction ]

Probe
MWG851  [ Marker Report ]
Locus
MWG851b
[ Show all 8 ]
Reference
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
Genomic
STS
STS primers
5' GTGCAATACCAGCAAACTCA
5' CATAGCAGAACGTCTCAAGT
STS size
301
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
AJ234592
AJ234591
MWG851-5
MWG851-3
Linkage Group
Barley 1 (7H)
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Insert Size
1.6
Clone Vector
Bluescript
pBS
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kleinhofs, Andris96.05.08
Kuenzel, Gottfried00.03