Query (optional)   in Class  

GrainGenes Probe Report: MWG858

[Submit comment/correction] [What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Probe
MWG858  [ Marker Report ]
Locus
Xmwg858-2
[ Show all 11 ]
Synonym
SynonymHAR35_21728
HAR35_3289
Reference
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
Genomic
STS
STS primers
5' CGCCTCGTCTGTCATACTCA
5' AAAGAGGATGGCAGCCG
STS size
271
Amplification Conditions
STS annealing temperature 60-62 oC
Sequence
AJ234596
AJ234595
MWG858
MWG858-5
MWG858-3
Linkage Group
2H
2
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Insert Size
1
1.4
Clone Vector
Bluescript
pBluescr.
pBS
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
ATMI92.09
Kleinhofs, Andris96.05.08
Kuenzel, Gottfried00.03

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.