Query (optional)   in Class  

GrainGenes Probe Report: MWG872

[ Printable Version ]  [ Submit comment/correction ]

Probe
MWG872  [ Marker Report ]
Locus
MWG872
Synonym
SynonymHAR35_17012
HAR35_20170
Type
Genomic
STS
STS primers
5' GACCAGAAGCTAATGGCGAT
5' CGTTCACACTCAAGCCCTCA
STS size
276
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
AJ234603
AJ234602
MWG872-5
MWG872-3
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03