Query (optional)   in Class  

GrainGenes Probe Report: MWG914

[ Printable Version ]  [ Submit comment/correction ]

Probe
MWG914  [ Marker Report ]
Locus
Xmwg914-5B
[ Show all 6 ]
Synonym
SynonymHAR35_42173
Type
Genomic
STS
STS primers
5' GCCATGACCGTCTTCCC
5' CCCCATAACATTCGGGTATG
STS size
269
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
AJ234644
MWG914-5
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03