Query (optional)   in Class  

GrainGenes Probe Report: MWG920

[ Printable Version ]  [ Submit comment/correction ]

Probe
MWG920  [ Marker Report ]
Locus
MWG920
[ Show all 20 ]
Reference
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
Genomic
STS
STS primers
5' GTCACCGCCCGTCACGTTGCGCTTCA
5' GAGTACCGCGACCGTCGCGCTCGAGC
STS size
183
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
AJ234647
MWG920-5
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03